Original
Paper
|
|
|
file on Synergy |
Acta Biochim Biophys
Sin 2006, 38: 58-62
doi:10.1111/j.1745-7270.2006.00122.x
Construction and Activity
Assay of the Activating Transcription Factor 3 Reporter Vector pATF/CRE-luc
Jun-Qing XU1,2,
Jing-Lan DENG1,
You-Sheng WU2,
Han-Yan FU2,
Rui-Hua WANG2,
Jian ZHANG2,
Fan LU2*,
and Zhong-Liang ZHAO2*
1 Department
of Nuclear Medicine, Xijing Hospital, Fourth Military Medical University, Xi‘an
710032, China;
2 Department
of Biochemistry and Molecular Biology, Fourth Military Medical University, Xi‘an
710032, China
Received: June 29,
2005
Accepted: August
29, 2005
This work was
supported by the grants from the National Natural Science Foundation of China
(No. 30271457 and No. 30470874)
*Corresponding
authors:
Zhong-Liang ZHAO: Tel/Fax,
86-29-83374537; E-mail, [email protected]
Fan
LU: Tel/Fax, 86-29-83374537; E-mail, [email protected]
Abstract Activating transcription factor 3 (ATF3), a member of the
activating transcription factor/cAMP responsive element binding protein
(ATF/CREB) family of transcription factors, is induced by many physiological
stresses. To investigate the activity of ATF/CREB in cells with physiological
stresses, we developed a practical reporter vector, the plasmid pATF/CRE-luc,
bearing activating transcription factor/cAMP responsive element (ATF/CRE)
binding sites. This plasmid was constructed by inserting three repeats of the
ATF/CRE binding element into the plasmid pG5luc, replacing the GAL-4 binding
sites. The plasmids pACT/ATF3 and pATF/CRE-luc were transfected into HeLa and
NIH3T3 cells, respectively, and the results showed that the expression of
luciferase was increased in a dose-dependent manner on plasmid pACT/ATF3. The
data suggested that the plasmid pATF/CRE-luc could be used as a sensitive and
convenient reporter system of ATF3 activity.
Key words ATF/CRE; luciferase gene; pG5luc; reporter system
The activating transcription factor/cAMP responsive element binding protein
(ATF/CREB) family of transcription factors in mammals represents a large group
of basic region-leucine zipper (bZip) proteins, which were originally defined
in the late 1980s because of their ability to bind to the consensus AP-1 or
“TGACGTCA” of the activating transcription factor/cAMP responsive
element (ATF/CRE) site [1]. ATF3, a member of the ATF/CREB family of
transcription factors, was isolated from HeLa cells treated with
tetradecanoylphorbol acetate [2]. ATF3 is expressed at very
low levels in normal
quiescent cells, but
can be rapidly and highly induced in different types of cells
by multiple and diverse extracellular signals including
mitogens (e.g., serum and epidermal growth factor) [3],
cytokines (e.g., interferon and interleukin-4) [4] and
genotoxic agents
(e.g., ionizing radiation and ultraviolet light)
[5,6].
In vivo, ATF3 is highly expressed in
situations of cellular growth or stress, such as liver regeneration, brain seizure, ischemia-reperfusion of the heart and
nerve damage [7–10].
It appears to function in the regulation of the
cellular stress response or in cell proliferation by forming homo- and
selective-heterodimers with certain other bZip proteins [5,11]. The expression
of ATF3 and other immediate-early genes is followed by the sequential
expression of a set of delayed-early genes and the onset of DNA synthesis [12].
Several genes have been implicated to be the targets, including gadd153/Chop10
[13,14], E-selectin [15,16] and phosphoenolpyruvate carboxykinase
[17].Although there is strong evidence that this transcription factor
plays an important role in the regulation of responses to stress stimuli,
little is known about the modulation and physiological significance of ATF3
induction. Clearly, in order to understand the significance of ATF3 induction
by stress signals, it is important to elucidate how it is induced by
extracellular signals and what target genes it regulates. So far, the main clue
for the physiological function of ATF3 has come from studies of its expression
pattern, not its activity.In the present study, we developed a plasmid bearing the sequence of
ATF/CRE, which could be driven by the binding of ATF3, used as a reporter
plasmid to detect the activity of ATF3. Using transient transfection and
luciferase activity assay, this plasmid was confirmed to be functional because
it could be induced to express luciferase by ATF3 in a dose-dependent manner.
It is reasonable to expect that the application of the ATF3 reporter plasmid
would then provide a more convenient tool for the research of the physiological
function of ATF3.
Materials and Methods
Bacterial strain and growth
conditions
Plasmid cloning was carried out in the Escherichia coli DH5a strain [18].
Procedures for preparation of E. coli competent cells and transformation
of target DNA into competent cells were as described previously [19].
DNA procedures and plasmids
Basic DNA manipulations and molecular techniques were employed as
described in Sambrook et al. [19]. Extraction of DNA from agarose gels
was done with a QIAEX II gel extraction kit (Qiagen, Valencia, USA). Nucleotide
sequence determination was performed by Sunbiotech (Beijing, China).The pBIND vector (Promega, Madison, USA; GenBank accession No.
AF264722) is a 6.3 kb eukaryotic high-copy-number plasmid bearing the renilla
luciferase gene preceded by the SV40 early promoter and a growth hormone
intron. In this study, the plasmid pBIND was used as a reference to normalize
transfection efficiency. The pBIND vector (Promega, Madison, USA; GenBank accession No.
AF264722) is a 6.3 kb eukaryotic high-copy-number plasmid bearing the renilla
luciferase gene preceded by the SV40 early promoter and a growth hormone
intron. In this study, the plasmid pBIND was used as a reference to normalize
transfection efficiency. The pACT vector (Promega; GenBank accession No. AF264723) is a 5.5
kb eukaryotic high-copy-number plasmid in which the CMV immediate-early
promoter drives expression of the herpes virus VP16 activation domain (amino
acids 411–456). The coding sequence of the ATF3 gene was obtained by
reverse transcription-polymerase chain reaction with primers GCAGGATCCTGATGCTTCAACACCCAGG
(underline indicating the BamHI site) and TCGACGCGTGCTTAGCTCTGCAATGTTCC
(underline indicating the MluI site). Then the sequence was inserted
into the BamHI/MluI sites of pACT to construct pACT/ATF3. pG5luc (Promega; GenBank accession No. AF264724) is a 4.9 kb
eukaryotic high-copy-number plasmid bearing the resistance gene for ampicillin,
and five GAL-4 binding sites upstream of a minimal TATA box, which in turn is
upstream of the firefly luciferase gene (luc+).
This plasmid was used as the vector of our reporter plasmid. Plasmid
pATF/CRE-luc was constructed as follows: a 77 bp DNA fragment containing three repeats of the ATF/CRE binding site
(TGACGTCA) was chemically synthesized and cloned into the KpnI/NheI
sites of pG5luc (121 bp) using standard cloning techniques. Thus the fragment
replaced the GAL-4 binding sites of pG5luc completely. Plasmid pATF/CRE–luc
could be driven by the binding of ATF3 to the ATF/CRE site and could be used as
the ATF3 reporter plasmid.The ligation products were used to transform competent bacteria.
Plasmid DNA of several randomly selected colonies was isolated by the
endotoxin-free ultrapure plasmid DNA mini-prep kit (V-gene Biotechnology,
Hangzhou, China). Plasmid pACT/ATF3 was digested with BamHI/MluI;
plasmid pATF/CRE–luc was digested with KpnI/NheI.
The size of the DNA fragment obtained on agarose gels gave a strong indication
of the probable positive clone.
Cell culture
HeLa and NIH3T3 cells were grown in 10% fetal calf serum/Dulbecco’s
modified Eagle’s medium (Promega). Cultures were maintained at 37 ?C in an
incubator with 5% CO2. The cells grew in a confluent
monolayer. When they were at 80%–90% confluence, they were transferred into a
24-well plate. Twenty-four hours after plating, the cells were serum-starved
for another 24 h to synchronize cultures into quiescence to be used for
transfection experiments.
Transient transfections and
luciferase activity assays
Following serum starvation of the cells, the ATF3 reporter plasmid
pATF/CRE–luc and/or pACT/ATF3 were transfected into HeLa and NIH3T3 cells
with Lipofectamine 2000 reagent (Invitrogen, Grand Island, USA). For each
transfection, 50 ng pBIND was added to normalize the transfection efficiency.
Every sample was transfected with the same quantity of reporter system
pATF/CRE-luc and a different dose of pACT as a balanced plasmid, to ensure every sample was transfected
with the same amount of DNA (Table 1). The cells were harvested
and lysed at 48 h post-transfection, and the firefly
luciferase and renilla luciferase were detected using the Dual-luciferase
reporter assay system (Promega) according to the manufacturer’s instructions.
All transfection experiments were performed three times.
Results
Construction of plasmid
pACT/ATF3 and reporter plasmid pATF/CRE-luc
After digestion by BamHI/MluI, pACT/ATF3 was divided
into two fragments, and the size of the smaller fragment was expected to be 546
bp [Fig. 1(A)]. The ATF3 cDNA present in pACT-ATF3 was sequenced to
verify the sequence integrity (GenBank accession No. NM_001674.1). The sequence
showed two mutations at position A001C and position G501A [Fig. 1(B)],
but the first mutation had no effect on the resulting translation product and
the second was silent. A schematic representation of the
construction of pATF/CRE-luc is shown in Fig. 2(A).
After digestion with KpnI/NheI, pATF/CRE–luc was cut
into two fragments, and the size of the
smaller fragment was expected to be 77 bp [Fig. 2(B)]. After
being treated with KpnI/NheI, pG5luc
was cut into two fragments. The size of the smaller fragment was
expected to be 121 bp [Fig. 2(B)]. The result of sequencing of ATF/CRE
(TAGCTCTCTCTC-TGACGTCAGCCAACGCGTCTCTCTCTGACGTCAG-CCAATCTCTCTCTGACGTCAGCCAAGGTACCT;
underlined nucleotides symbolize the ATF/CRE sites) was consistent with our
design.
Luciferase activity correlates
with the quantity of transfected ATF3
To assess whether the plasmid pATF/CRE-luc functions effectively,
transient transfection assays were performed in both HeLa and NIH3T3 cells. Analysis
of the activity of luciferase after cotransfection of the plasmids pBIND,
pACT/ATF3 and pATF/CRE-luc indicated that ATF3 could stimulate the expression
of the luciferase gene controlled by ATF/CRE both in HeLa and NIH3T3 cells (Fig.
3). The results indicated that the activating effect of ATF3 could be
dependent on the binding of ATF3 to the ATF/CRE site, suggesting that the
plasmid pATF/CRE-luc did work. Moreover, this activation effect was
dose-dependent on the amount of transfected ATF3 (Fig. 3). In these
experiments, the basal activity of the ATF3 in cells was low in HeLa cells and
NIH3T3 cells, which may reflect the lack of some important transcription
factors for basal ATF3 transcription in these cells.
Discussion
Although a lot of evidence has confirmed that ATF3 is a
stress-inducible transcriptional factor, little was known about the
physiological significance of ATF3. It was not clear how the activity of ATF3
changes with different cell types and different stresses. Furthermore, there
must be chemical factors or proteins in the cells, which could affect the
activity of ATF3. To answer these questions, we need a method to detect the
activity of ATF3 in vivo. One very useful technique is an ATF3 reporter
system.In this study, a new integrative ATF3 reporter plasmid was
constructed and proved to be an efficient reporter of the activity of ATF3 in
HeLa and NIH3T3 cells. To construct this plasmid we utilized the mammalian
two-hybrid system (Promega), which was designed for detecting protein
interactions in vivo. This system was very beneficial for the
construction of a reporter system of transcriptional factors because it was a
dual-luciferase system. The pBIND vector, which carried a renilla
luciferase gene, could be used as a reference to normalize transfection
efficiency. The pG5luc vector carried the firefly luciferase gene (luc+) controlled by five GAL-4 binding sites with a minimal TATA box, so
we could replace the GAL-4 binding site with the ATF/CRE site.To construct the ATF3 reporter vector, the GAL-4 binding sites in
the pG5luc vector were replaced by ATF/CRE. To ensure that this reporter system
functions effectively, the repeat number of ATF/CRE sites and the distance
between two ATF/CRE sites were
investigated. Finally, the reporter vector carrying three repeats of ATF/CRE
were effective. Our data showed that the quantity in the group of
cotransfection of ATF3 and ATF/CRE was much higher than that in the group of
transfection of only ATF/CRE in HeLa and NIH3T3 cells. This means that the
plasmid pATF/CRE-luc could use the ATF3 reporter successfully. This reporter
system could help us to understand the change of activity of ATF3 in different
cells and under different stresses. From these results, it could also be
deduced that ATF3 is expressed at very low levels in cells under normal
conditions, even in tumor cells. This could be very important to our future
study.In conclusion, our successful construction of an ATF3 reporter has
offered a convenient system to study the physiological significance of ATF3
induction, and to investigate what influence different extracellular signals
have on the activity of ATF3. This work also gave rise to the idea of
constructing a practical reporter system of transcriptional factors.
References
1 Landschulz WH, Johnson PF, McKnight SL. The
leucine zipper: A hypothetical structure common to a new class of DNA binding
proteins. Science 1988, 240: 1759–1764
2 Hai T, Liu F, Coukos WJ, Green MR. Transcription
factor ATF cDNA clones: An extensive family of leucine zipper proteins able to
selectively form DNA-binding heterodimers. Genes Dev 1989, 3: 2083–2090
3 Weir E, Chen Q, DeFrances MC, Bell A, Taub R,
Zarnegar R. Rapid induction of mRNAs for liver regeneration factor and
insulin-like growth factor binding protein-1 in primary cultures of rat
hepatocytes by hepatocyte growth factor and epidermal growth factor. Hepatology
1994, 20: 955–960
4 Drysdale BE, Howard DL, Johnson RJ.
Identification of a lipopolysaccharide inducible transcription factor in murine
macrophages. Mol Immunol 1996, 33: 989–998
5 Hai T, Wolfgang CD, Marsee DK, Allen AE,
Sivaprasad U. ATF3 and stress responses. Gene Expr 1999, 7: 321–335
6 Abe T, Oue N, Yasui W, Ryoji M. Rapid and
preferential induction of ATF3 transcription in response to low doses of UVA
light. Biochem Biophys Res Commun 2003, 310: 1168–1174
7 Hsu JC, Laz T, Mohn KL, Taub R.
Identification of LRF-1, a leucine-zipper protein that is rapidly and highly
induced in regenerating liver. Proc Natl Acad Sci USA 1991, 88: 3511–3515
8 Chen BP, Wolfgang CD, Hai T. Analysis of
ATF3, a transcription factor induced by physiological stresses and modulated by
gadd153/Chop10. Mol Cell Biol 1996, 16: 1157–1168
9 Tsujino H, Kondo E, Fukuoka T, Dai Y,
Tokunaga A, Miki K, Yonenobu K et al. Activating transcription factor 3
(ATF3) induction by axotomy in sensory and motoneurons: A novel neuronal marker
of nerve injury. Mol Cell Neurosci 2000, 15: 170182
10 Takeda M, Kato H, Takamiya A, Yoshida A,
Kiyama H. Injury-specific expression of activating transcription factor-3 in
retinal ganglion cells and its colocalized expression with phosphorylated
c-Jun. Invest Ophthalmol Vis Sci 2000, 41: 2412–2421
11 Hai T, Hartman MG. The molecular biology and
nomenclature of the activating transcription factor/cAMP responsive element
binding family of transcription factors: Activating transcription factor
proteins and homeostasis. Gene 2001, 273: 1–11
12 Lanahan A, Williams JB, Sanders LK, Nathans D.
Growth factor-induced delayed early response genes. Mol Cell Biol 1992,
12: 3919–3929
13 Wolfgang CD, Chen BP, Martindale JL, Holbrook
NJ, Hai T. gadd153/Chop10, a potential target gene of the transcriptional repressor
ATF3. Mol Cell Biol 1997, 17: 6700–6707
14 Fawcett TW, Martindale JL, Guyton KZ, Hai T,
Holbrook NJ. Complexes containing activating transcription factor
(ATF)/cAMP-responsive-element-binding protein (CREB) interact with the
CCAAT-enhancer-binding protein (C/EBP)-ATF composite site to regulate Gadd153
expression during the stress response. Biochem J 1999, 339: 135–141
15 Chen BP, Liang G, Whelan J, Hai T. ATF3 and
ATF3 delta Zip. Transcriptional repression versus activation by alternatively
spliced isoforms. J Biol Chem 1994, 269: 15819–15826
16 Nawa T, Nawa MT, Cai Y, Zhang C, Uchimura I,
Narumi S, Numano F et al. Repression of TNF-a-induced E-selectin
expression by PPAR activators: Involvement of transcriptional repressor
LRF-1/ATF3. Biochem Biophys Res Commun 2000, 275: 406–411
17 Allen-Jennings AE, Hartman MG., Kociba GJ, Hai
T. The roles of ATF3 in glucose homeostasis. A transgenic mouse model with
liver dysfunction and defects in endocrine pancreas. J Biol Chem 2001, 276:
29507–29514
18 Hanahan D. Studies on transformation of Escherichia
coli with plasmids. J Mol Biol 1983, 166: 557–580
19 Sambrook J, Fritsch EF, Maniatis T. Molecular
Cloning: A Laboratory Manual, 2nd ed. New York: Cold Spring Harbor Laboratory
Press 1989